Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633375
Length 655 bp
Fasta Format > whdp14n13
cccctctcctccaaggtaagcccgcggcggcggcgagcgagcggcggcga tgacgacccgcttcaagaagaaccggaagaagcgcggccacgtgtccgcc gggcacgggcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaa cgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccatcccg gctacttcggcaaggtcggtatgcgctacttccacaagctcagcaacagg ttctacaccccgacggtcaacgtcgagaggctctggtccatggtgccgtc cgagaaggcggccgaggccggcggcgacaaggcccccgtggtcgacgtct cgcagttcggctacttcaaggtgctcggcaaggggatgctgccggagaag cccatcgtcgtcaaggccaagctcatctccaagatcgcagagaagaagat caaggccgccggcggcgctgtcgtgctcgttgcctanggttctgttcgcg accgtgccttganatctattatatctgaactattanttgtttcccgtacc ancaatttgtgttgaacaagacatcgttantttgttatcctggttcctgt gtggtaaaccaacatcttatganaattttgcnctatgttatgccanttta tatca
Download
page-top