Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ605064
Length 797 bp
Fasta Format > rwhv3n3b03
cagttaagcaagaacacacagaagtatttatctgttctcatgaaccatca tatcacaacaaaatggtcagaccgatgcaaggtgcgacatggaagtggac aaaccgaaccgtgcttttgcacaaatttcttgtaatttacatcatgatag tacaactcaggccacaggagaacatgcctcattgcgagcacagtcccaag acaccttacttgccggggacaaagttggtggcgaatgcccatgcattgtt gttgacggggtcggcgatgtggtcagcgaggttctcaagtgggcccttgc ccgtgacgatagcttggacaaagaagccaaacattgagaacatggcaagg cgaccgttcttgatctccttcaccttgagctcggcgaatgcctcagggtc ttcggccaagccaagagggtcgaagctaccgcctgggtagagtgggtcaa cgatctcaccgagtgggccgccggcaacacggtacccctcgacggcaccc atgagcacgacctggcatgcccaaatagctaggatgctttgtgcgtgcac taggctggggttgccgaggtagtcgagaccaccctcactaaagatctggg agccggccttgaaccaaacggcctcgccaaacttgacgccgttgcgggcg agcaactcanggaagacacaaccaagtgccccaagcatggcccancgaca gtggatcacctccanctcccggttcttggagaaggtctccgggtcanccg aaagtccancantgtcccacccatantcnccagggaactcaccggtc
Download
page-top