Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ569770
Length 352 bp
Fasta Format > rwhms5m23
aagaaacaggtgcatttatagcaggagtagtcttatagcagcgttcttag gactggcaggaggcttaacatatcacacgagtgagcattgctgccggagc ttgcgtcgcttatttccaccacgggttgtcgccggtcctgaagtcggtct ccacccacggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaaca agggccagcgacagaggtgcaggcccacggacaaccttgccctggttgtt gtactgggatccatggcaggggcagaggaacttgttctcggcggcgttcc acggcacgacgcatccaagatgcgtgcacacggcgttgatcccgtaggtg gc
Download
page-top