Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586148
Length 708 bp
Fasta Format > rwhrd9f12
cctcgagcattcggtgtaaaaaacacacaaatctggatcaaacttgtttc acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaa gcactagataccaagtatcgcaggtaggcaaccacgcacagctgcttact tgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcg gacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgat ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgt tgccactctcagttagaaggctgacatatccatcatcagttatgtcaatc agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatga aggaacgatatcctcaagcttctttccattaaagatgtcaatggcaacaa agtgacactttgcgtgaccatgcttcccagtcttggaggtggagacctca acaaccttgcagggacgggccttgatgacgatgtgtccacccttgcggat ggcgccggcctgctgagggtaggtcttggaggcgccggagtcggccttgg actcgaagtggtgctcatcggtgtccgacatctccgacgatcctcctggg tccgggggcaagtggggtggtggagacnanatgcancggcagcgaggggc ggatggat
Download
page-top