Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ564079
Length 804 bp
Fasta Format > rwhkv5a08
tgtatgtctgaacattcaccagcgatatggaaaatatagccaagtatcta tccgtttttcccgagtcacgattcaacagcggacgtcttagtagaaccat aacgcaacgacgggtcgagagcagttcccagattccatgacaggacggtg acgctggtacaaaatatgcaaatccccactaaaacttattcagctcttgg acacttccgaatgactgactgactggtataagatgacggtgctagacaga gtctgccttggtgtagatccgtacggcgacggccaggcccagtatcgcga gggggaccaagaactggaggatcttgatgacgaactcgggggtcttgtcc tggttgtagtgcggctgcttgggcggcgtgtacttgaccttggtgggtat cgtggtcgcgtcgatctcgccgacgtagtactcgtccatcatcgcccggg cggttgtgctgtgtcccacgtcctcgaagtcgtcggtcgcgtccttggca gttgaagacagcaagacgtcgtcgcctccagggtggtcatcaagaaactt ggtcacattgtacaccttgccgccgatgacgagccancagtcgtccttgg agctgtgcttggcgacctcctccagggtgaagagcttgccaccggacgac gacatggtctcctcctcctcctcctnntcntnntntntctnnttnnnnng anncnnncnanantgatncctcnngccnaattcctncnnnccnnnnnatc cnntanttctnnancnnncnccnccnnnnngnanctccnnttttnntccc nttt
Download
page-top