Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ698781
Length 156 bp
Fasta Format > whsd14e23
ggtgttgagacaccgtttaaggctcctgaataatcctcgcattcttgtcc ttggaaaagttttaccagcattgcagtcaagctgaagaatcgtctgtaat aatcattggcagcatcagcgcatataatttgtttgttctagttcttaaaa aaaaaa
Download
page-top