Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692745
Length 513 bp
Fasta Format > whsc10i02
aagcttgctgcatagcaagcaatggggtactctaaaaacctagcggctgg cctgttcgccatgctgttcctagctccggccgtcctggcatccgaccccg atcctcttcaggacttctgtgttgccgacctcgatggcagggcagtctcg gtgaacgggcatccatgcaagcccatgtcggaggctggtgacgacttcct cttctcgtccaagctggccaaggccggcaacacgtccaccccgaatggct cggccgtgacggagctcgacgtggccgagtggcccggtacgaacacgctg ggtgtgtccatgaaccgtgtggacttcncgccgggaggcaccaacccgcc gcacgtccacccgcgtgggaccganatcngcatggtgatgaaangtganc tcctcnttgnaatcctcngnancctcnactccnnaaanaanctctactcc angntgnngcntgntnnananannntcctnntnnnnnnnnnnntnatnna nttnnnnnnnnnn
Download
page-top