Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586885
Length 659 bp
Fasta Format > rwhsc12d11
cacttcttgaacttgccgccgccgccgaacatgccgtgcttcccatgctt gccgtgcttgaacttgccgtggccgtgcttcccgtgcttgaacttgccgc cgtggtggccgtacccgccgccgtagcctccgtggccgcccatcatgcct cccatcatatgtccacctccaccgtggccgccgtgagaaagcttgtgtgc tccgtaagcggcggcagcagctgctgctcctccagccagcatgccaccca tgcccatgcctcctcctccatggctaccactgtgaccagatgagccaggg tagccagcaggggggtagccatgctgctgtggagggtagccatgctgctg cggtgggtagccatgctgaggagggtagccttgctgagggtatccatgct gctgcggggggtacccgtggccaccanatgggtagccatgaccaccacca tgagcaccggcaacaccatgcatgatgttggagagganccccttctcccc gtcanggcctcccgctccangtgcanganggtacnccccangtgcangan ggtatgccccangtgcangtgggtaanctccangtgcangcnnntatcct tgntgtgnangnnaactcnttnntnnnnannnnaanntnnntnntnnnnn nnnnannnt
Download
page-top