Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ735465
Length 775 bp
Fasta Format > rwhsh10d03
ctgggtttttacaacaatagagtacaatcttcgctgatattaacaaaata cactcctctcgattgttttttatttatttacgggaaaatgagagaagccc atgcaggcaatggcagtacaattctagatgaacggttcacatagcaacag tatttttatgctacactgggtggtgggtgaacagcaagcccacactcagc gtccctactgtaaacccaaggtccaaaggaaaaaaccaagcatgactatt gaaaacttccatgccatcgtgcgaaaattcatatgtaaaactaatccatc ttgacatttgaatataggagcgtgtccctggtaagcggcatgttcatgag caggcagatcccaatgagagttgagacaaggaggatgatccctgtaatcc atgcaagactcaatctaacaagatatatagcagctatagaagctgtagca ttagttttcgatgcttctgcaagccgtcttgagatatgcaatgaagatgg tccatcgatgatggatgccaaggatgttgaagcctccttagtggatatta ccagcccaacaattttcccgttatatgctccctgcaattgatcaaatgct ttggtgagagctgtctgaactacttcagctccctgcttaacaatttctgc agaaccatattcatcttccagagccttaatgcccgtgaagcggcatacta ataactctgcagggctcacgatgcctcctgagaaatcttcatgaacctga ataccccttttgatggttttgagaa
Download
page-top