Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573965
Length 813 bp
Fasta Format > rwhok20k18
acaacgaattatatgcgctgatgctgccaatgattattacagacgattct tcagcttgactgcaatgctggtaaaacttttccaaggacaagaatgcgag gattattcaggagccttaaacggtgtcttaacacccaaggaaatcgaggt gcctgccacttcacctactcaggctaaagctcctggtatgcaacaaaatt aggtgggagacaaataatcgacagaaagagcagctggtgctcagatatga tcgcaaactgcttttgtgtagtctgatgttgatgacttcccaccaagatc agcggttctgtacttcccctcggcaattgtctggaggatggcattgtgga tccggtctgcttggtcattgaattgcaagtggcgcaacatcataacagca ctcaacataagagcagttgggtttgcaaggttcttgccagagatatcagg tgcagaaccatgaacagcctctgccagacaaatgccaccttcaccaatgt tgcagctgggagttaagcccaagcctccgatcaaaccagcacatagatca ctaataatgtcaccatacagatttggcatcactaatacatcaaatgtacc aggattcttcacgagtgtcatgcagcaattgtcaatgatgacttcctcat atgtgatttcagggtacttctcagctacttcacggcaacacttgaggaaa agtccgtctgttttcctcatgatattagctttatgtatcgcagagaccct ctccctgccattggctttggcataatggaaagcatactctgccactctca aacttgcttggcg
Download
page-top