Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619494
Length 569 bp
Fasta Format > rwhvh1m20
gaggcacgggtatctcacttagacaagtttgaattctaacaaactgcgaa taggtttgctccacgattcagttcgaaatacagaggaaatagcgaactac agaggaagtagagaactacacaagtcgcggtatcatcaaacttttgggat ctgcaagggggcaaggaagagcctagccgccgaagccgtagagggtgcga ccctggcgcttgagggcgtagacgacgtccatggcggtgacagtcttgcg gcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagga agatcttgagcacgccgcgggtctcctcgtagatgaggccggagatgcgc ttcacgccgcccctcctcgccaggcgccggatggcgggcttggtgatgcc ctggatgttgtcncgcancaccttcctgtggcgcttggcgccgcccttgc cgagccccttgcctcccttgccgcnccccnacatggctgaanatctcttc ttggttcnagccncnanangatggngnncnannannnnncntcnnnccna attnntnnnnncnnnnnna
Download
page-top