Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ696677
Length 481 bp
Fasta Format > whsc5k22
gttcctcatcccgcgcgggctcatgcacttccagttcaacgttggtaaga cggaagcctacatggttgtctccttcaacagccagaaccccggcatcgtt ttcgtgccgctcactctcttcggttccaacccgccaatccccacgccggt gctcaccaaggcgctaaggatagaggccggggtcgtcgaacttctcaagt ccaagttcgctggtgggtcttaatccctgggagcttgccctggaatgatc agtatataatttgatatatgcataccagtgaaatttaataattgttcagc ataagacacgtattcaagcttctagctaagctcgcatgcagttgtaataa gattgaataagttagcctcgcggtttagccttcagagccaatacgaggaa tcgaaatgtactgctttttattgttgtgtttgttcttttcattgaacgga atatataattatcattttcgtaaaaaaaaaa
Download
page-top