Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619423
Length 817 bp
Fasta Format > rwhvh1i06
aaacgtatatagttgacatattgtataatattatgcgtccgtgcatatac atagccaccgatagcattcacatacgagcatgctttctcgagccatgttg gtacatgaacatggacatacacatattcttaggaacaaataagaaagata aatggagaaggaaaacccaaagcaatgtcagagttgacaaaactgcaatg gcactttatatatggcctgtcgtgagtgagctgtttaggccttgccggac tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacctg acgcatgttgtcgaatccgatgatgcggacatacgcgtcagggtactcct tcttgacctcctccacctcgttgatcacctgtgtggcgtcagtgcacccg aacataggcagcttccacattgtccaataccggccatcgtagtacccagg agatgcgttgtgctcacggaagatgaacccaaccttgctgaactcgaggc aaggcacccacttggagcggatcaggtagtcgacctgcttgaggagggcc tccgtgctgagcggtggcaggtaagacagggtctcgaacttcttgatgcc ctcgatgggccacacctgcatgcacctgatccttccaccgttgctgacgc tgccgaggctagcgccgttggagcggcggctgacggggaggccggcggtg gacttgagcccctggaaaggancgacggaggtggccgacnangccatcac ggngggggccatggctgnactatgtangtatatancttgctaaggancct cntgccnaattcctgca
Download
page-top