Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607557
Length 406 bp
Fasta Format > rwhva13j08
gtctgaacattcaccagcgatatggaaaatatagccaagnatctatccgt ttttcccgagtcncgattcaacagcggacgtcttanctataaccataacg cancgacgggtcgagagcagttcccagattccatgacaggacggtgacgc tggtacaaaatatgcaaatccccactanaacttattcanctcttggacac ttccgaatgactgactgactggtataagatgacggtgctagacaaagtct gccttggtgtagatccgtacggcgacggccaggnccantatcgcgagggg gaccaagaactggaggatcttgatgacgaantcnggggtcttgtcctggt tgnagtgcggctgcttgggcggngtgtacttgaccttggngggtatnntg gtcncg
Download
page-top