Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619206
Length 214 bp
Fasta Format > rwhvh19k06
aacttcttgatgccctcgatgggccacanctgcatgcacctgatccttcc accgttgctgacgctgccgaggctancgccgttggagcggcggctgacgg ggaggccggcggtggacttgagcccctggaaaggagcgacggaggtggcc gacgaggccatcacggtgggggccatggctgtactatgtaggtatatagc ttgctangaggagg
Download
page-top