Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628805
Length 818 bp
Fasta Format > whcs16o10
atggagaggctgtggggtgagaacttctttgacccagccacaaagaaatg gacctccaagaacactgggacagctacctgcaagagaggtttcgttcagt tctgctatgagccaatcaagcaaatcatagccacctgcatgaatgaccag aaggataagttgtggcctatgttgaagaagcttggagtgaccatgaagaa tgacgagaaggacttgatgggcaaggctctcatgaagcgtgtgatgcaaa cttggctgcctgccagtcgtgctctgcttgagatgatgatatttcacctc ccctctccttcaaaggcccagaggtatcgtgtggagaacttatacgaggg cccccttgatgacatatatgcaaatgctatcagaaactgtgaccctgatg gtcctcttatgctgtatgtctccaagatgattccagcatctgacaagggt agattctttgcctttggacgtgtttttgccgggagggttgcaactggcat gaaggtccgtatcatgggtcccaactttgttcctggccagaagaaggatc tgtatgtgaagagtgtccagcgtactgttatctggatgggaaagaagcaa gagtctgttgaggatgttccctgtggtaacactgttgctttggttggttt ggatcagttcatcacaaagaatgcaaccctgacaaatgagaaggaagttg atgcctgcccaatcanggcaatgaagttctctgtgtcccctgttgtgcgt gttgctgttcantgcaaggtggcctctgatcttcccaancttgttgaggg tttgaancgtctggcaaa
Download
page-top