Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ674568
Length 653 bp
Fasta Format > whms17n22
agtgatgctggcaaaaaagaaatccatatgcagcttgagaagatgaagaa gtatgctactgttgtccgtgttatcgcccatacccagatcaggaagatga agggattgaagcagaagaaggctcacctcatggagatccagatcaatggt ggcaccatcgccgataaggttgactatggttacagcttctttgagaagga agtccctattgatgctgtgtttcaaaaggatgagatgattgacatcattg gagttaccaagggtaagggttacgaaggtgttgtgacacgttggggtgtc acccgtcttccccgcaagacccacagaggtcttcgcaaggttgcctgtat tggtgcctggcatcctgctagggtgtcctacactgttgctcgtgctggtc agaatggttaccaccaccgaactgagatgaacaagaaggtctacaagatt ggcaaggttggacaggaaactcatgatgcctctaccgagttcgacaggac tgagaaggacatcactcccatgggtggcttccctcactatggtgtggtga aggctgactacctgatgatcaagggatgctgtgtcggccccaagaagcgg gtggtgaccctccgccagtccctgctgaagcagacctctcgtctggccct gga
Download
page-top