Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523151
Length 893 bp
Fasta Format > rwhcs8n21
agtgccagtatcacgacagataggagtacattccaatagcaatacagcca cgactcagtagacacaaaataatagtgcagctctcttagcagcaaaacca actacactatataggagataacagaaccaaaagtttagagcttgtcctcg aaatcagacagaggggtcatctgttccttcagacccttgcgcttgcggat ctccgtgacaagggtggcagactgggagccggcctccaaaggatccgaag acatgatgtcccagtgatcgaacacacactgggggaaagcctggccagat gtcgcagccctgagggtacttgagaacccgaacgactcgatgaccgggag gtaagccttgatgttgtacagcggggtaccaggcctctgcatctcctcaa acacgtgccctctcttctgattcagaacaccatagataccgccaagtgca ttctccggggcctggatctcaaccaggtacacaggctccagcagccttgg cttagcagtgagctgagaagcataaatgaccctcctggctgttgggatga cctggccaccacccctgtgaatagcatcagtgtgcagaacaacatcacag acctcaaagcagatgccacgcatgttctcctcagccaaagcaccttcttt cgatgcccactggaacccagccacaacagagtccttgatttcattcagat actgcactcccttacacatgtcgacaaccatgttggggccagtcgtctca ggtccaaagcaccaaatcttcttggcaagatccttgtcccagccaaactc ctcagatagggatcttagagcgcaccttaggatcatcacgtgggccaatg cggccatcatcaatggcctcagccagtccctcctccaatgggc
Download
page-top