Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX197956
Length 718 bp
Fasta Format > whxu_21068_m19r
ATTATAGTACAGCTTGAAAATTGGGCTCTAACCACAGCAGCCACAGTAAT TAATGTACACAGGCAGTTTTGGAGCAAACATGCTTCCCTGCTCCTCTCTA CAACACATTTGGGGGCTGCCATGGCTAATTCACGGCACAAGAAGAACTCA GCAGCAAGTGGAGGATCAAAAAAAATATTGGGATTAGAATGTAGCGACAT TCTGGGAGCAGTATTAAGTAGATATACAGACGGACAAGTGTCTCCCGGTC TCAGCTTTGGGTCTTCTCTACCTTGGCCTTGATCTTCTGCTCAAGGACCG CCTTCTCCGTGTCGAGGTTGAACATTCTGTTGAGGGCGTGCATGTTCTCC AGCGTTTCGTCCAGGGTGCGGCTGTCGCTGCCGTCGCATCTCAGGTGCTG CAGTGGGCCGTGAAGGAGCTTGTTCACTATACCCGTGCTCAGCTCCTCGA TGGACCTTCTCATCTTCTTGTTGAGATTGTCTTCCCCGATCTTCTGCAGG CACTTCTCGAGCTCAGATGCCCTGATCCTGTCGGCGTACGACCTCAGCTT TTTGATGGTCGGAACCGTCTCCAGTGAGTCCCTCCAAGCCTCGAACCGTT TCAGCTCTTGGGTAATGATTGTTTGGGCCTCCATTGCTTTCCTGANNCGG TCTTCCTTATTGGCTTCCACCACCTCTNNNNNNNNGTCGACATTGTATAC CCGTGCATGCTCCACCTC
Download
page-top