Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ275118
Length 666 bp
Fasta Format > rwhoh6c13
agctatgtctgtatngacacacatacagtataacacttcaatgactgagg ggtaatcatggaacactgacatatagttattcattaacagattgtggcta cactcttgaaaagttgacgaaccaaacataaaaaaacggaacagacaaaa tcagaaagaccagagcaggatctataaaatcttcaaggcaaacaatcatt gcctacaacatatgacacagcacagtgttatattgttttcggtttaatac aatagccatcccacaaaatggcacctggataggtaatattgtggtctgat tactcaagcttccctcagatggtaatgcaacttacttggccatcatgact ttaacaaattcgtcatagttgatctggccatcaccatcaacatcagcctc acggaccatctcgtcaacctcctcatcagtcaacttctcaccaaggttgg tcatgacatgggcgcagttcagcagcagagataaaaccattttgatcctt gtcaaacacacggaatgcctccttgagctcttcctcagaatcagtgtcct tcatcttgcgggccataaggttgaggaattcagggaaatcaattgttcca ttgccgtcagcatccacctcattgatcatgtcttgaagctctgcctcagt gggattctgccccagg
Download
page-top