Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ617185
Length 570 bp
Fasta Format > rwhvh10p04
tgtttaggccttgccggactcctcgcagcccggtggcttgaaggcgatga agctgacgcactgcacctgacgcatgttgtcgaatccgatgatgcggaca tacgcgtcagggtactccttcttgacctcctccacctcgttgatcacctg tgtggcgtcagtgcacccgaacataggcagcttccacattgtccaatacc ggccatcgtagtacccaggagatgcgttgtgctcacggaagatgaaccca accttgctgaactcgaggcaaggcacccacttggagcggatcaggtagtc gacctgcttgaggagggcctccgtgctgagcggtggcaggtaagacaggg tctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatc cttccaccgttgctgacgctgccgaggctagcgccgttggagcggcggct gacggggaggccggcggtggacttgagcccctggaaaggagcgacggagg tggccgacnaggccatcacggtgggggccatggctgtactatgtangtat atancttgctangangangc
Download
page-top