Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ599770
Length 660 bp
Fasta Format > rwhv16n20g20
atgtctgaacattcaccagcgatatggaaaatatagccaagtatctatcc gtttttcccgagtcacgattcaacagcggacgtcttagtagaaccataac gcaacgacgggtcgagagcagttcccagattccatgacaggacggtgacg ctggtacaaaatatgcaaatccccactaaaacttattcagctcttggaca cttccgaatgactgactgactggtataagatgacggtgctagacagagtc tgccttggtgtagatccgtacggcgacggccaggcccagtatcgcgaggg ggaccaagaactggaggatcttgatgacgaactcgggggtcttgtcctgg ttgtagtgcggctgcttgggcggcgtgtacttgaccttggtgggtatcgt ggtcgcgtcgatctcgccgacgtagtactcgtccatcatcgcccgggcgg ttgtgctgtgtcccacgtcctcnaagtcgtcggtcgcgtccttggcantt gaanacancaagacgtcntcncctccanggtggtcntcnnnaaacttggt cacnttgtacaccttgccnccnatnacnanccnnnnnncnnccttgnanc tgnnnttnnnnacctcntnnnngnnnnnnancttnnnnnnnnannannan nnnnncnnnt
Download
page-top