Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557053
Length 275 bp
Fasta Format > rwhkp19o05
ggggccttgtcgccgccggcctcggccgccttctcggacggnaccatgga ccaaagcctctcgacgttgaccgtcggggtgnagaacctgttgctgagct tgtggaagtagcgcataccgaccttgccgaagtagccgggatggtacttg tcgaagaggatgcggtggtggtgcatgcctccngcgttaccgcggcctcc gggatgcttgcngngcttgcccacacncccntgcccngngganacntgnc cncncttcttcnnnttcttcttnaa
Download
page-top