Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ520744
Length 855 bp
Fasta Format > rwhcs19j04
gcaaatcgtaacatataaccattcaagatacacaactagaagaagatact gatctccaaactccatccggtgttacaagtccaacgattcaagagctaat aagtacactagaaagaatggaatgaaggtgtaagatgtagtaggcctatg tagaagcatggactcaaggatggcgcggccaagtttgcgtctccatttgg gtaacatggatggcggctgcctgcatttcaagaagagcagcagctcgtct tctgttcgacaggttgcccgcgtatctgcaccgtggctgggcgagcgctg tttgcggctggctggctcgccatcctgtccttgattgaagcagacatagc catgaaagcctgctcaacgttcaaggcattctttgcactggtctccatga atgggatgccaatctcatcagcaaatgccttcgctgtctcatatgataca actcttttgtcagtgagatcagatttgttccctacaagaagcttgttaac attctcactagcatagcgatcaatctcgttcaaccactgcttcacattgt tgaagctgtcctggtctgtcacgtcatagacaataatgatcccgtgagcc cctcgatagtagctgctagtaatagttctgaagcgttcttgcccagcagt gtcccagatttgcagcttcatagtctttccatcttgctccacggtacgta ttttgaaatcaacaccaatagtactgatataactctccaggtacgagtca tcggcaaatcttaagagaaggcatgacttgccaacacctgagtctccgat aagcagaagcttaaagagatagtcatactccggattcatggcgaggtcgg gatcc
Download
page-top