Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ552992
Length 814 bp
Fasta Format > rwhhg4n02
gtagaagtcaacatatggtctaatttttgtagttaccagtaacttggaag atatctcagaagcacgctaatctgttggcattaatttagaagcaataaag agataattacatagacatgggcgagcacctaaagaacggcgtcacagatg ttccccttcacaacctcctcgaggttcatgttgtccaggtaatcatggac gaggagcccattgacgacggccgccaggtgcttgagcgtgtgcagcacga ggttgagtacgccgcctgcgcaagctcgtagcagctctccacgcccatcg ccttatcgcccaggaccttaatcttagacctggctgcttttccctccttt agtccatgtatgatgattttcacctgatcctgtatggcatctctctcaac cactatatcttgcattttagcttgcttagcagccttggaactgaccctcg gtctggttttttcaagggtcttaatttctttgaccagtcgcctctcctcg tctaaagatatgctctcatgacttatgtgttgattcaatctctcatgctc aagctcttcaacagaagagcacaagcctgcactctctgctcacataacat tattttcggcatggaactcgcctaaacacttcctgaaagtttttatctcc tccaacttctcgttaaaatcctaattatattgcctgttctcagcactcaa cgaccttagagaacagcagcacgctgagtcagttactgaagaaagcttca gggcatcatcaaactgcagtagcattgactgagatctgcctctgcttgtg ctgcgggtatgccc
Download
page-top