Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ660547
Length 796 bp
Fasta Format > whhg4n02
ccgcagcacaagcagaggcagatctcagtcaatgctactgcagttgatga tgccctgaagctttcttcagtaactgactcagcgtgctgctgttctctaa ggtcgttgagtgctgagaacaggcaatataattaggattttaacgagaag ttggaggagataaaaactttcaggaagtgtttaggcgagttccatgccga aaataatgttatgtgagcagagagtgcaggcttgtgctcttctgttgaag agcttgagcatgagagattgaatcaacacataagtcatgagagcatatct ttagacgaggagaggcgactggtcaaagaaattaagacccttgaaaaaac cagaccgagggtcagttccaaggctgctaagcaagctaaaatgcaagata tagtggttgagagagatgccatacaggatcaggtgaaaatcatcatacat ggactaaaggagggaaaagcagccaggtctaagattaaggtcctgggcga taaggcgatgggcgtggagagctgctacgagcttgcgcaggcggcgtact caacctcgtgctgcacacgctcaagcacctggcggccgtcgtcaatgggc tcctcgtccatgattacctggacaacatgaacctcnaggaggttgtgaag gggaacatctgtgacgccgttctttangtgctcgcccatgtctatgtaat tatctctttattgcttctanattantgccnncnnattancgtgcttctga natatcttccnagttactggtanctacnnnaattanaccntatgtt
Download
page-top