Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig1750
Contig Information
Length 679 bp
Tissue Dormant seed with water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
rwhem4j18    rwhem7b22    rwhem16a08    rwhem20c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cobalamin-independent methionine synthase [Triticum monococcum]
Score 664
Evalue 7.29346e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig1750
GTACGTACAACTCAGACTTAGATGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCAC
ATGGCGCCGCGCCGCGCCGAGAAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCT
CCTTGCAATTAAAATGGGGGAGCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGG
CTTGACCTCGGCATACTTGCGGGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCG
ATCTCCTCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCT
TCTCGTCGGACCGCGAGTTCTCGATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTANCACATGTGGGTGTG
GATCTGGGTGGTGTCCTGGACACCNCANTTGNTGATCCTNAANGANTGCACNGNCCNNNCCNNNTANAAANNNTGCTCC
page-top