Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig99
Contig Information
Length 612 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl46h22    whfl46h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S25-1 [Zea mays] >gi|195658723|gb|ACG48829.1| 40S ribosomal protein S25-1 [Zea mays]
Score 337
Evalue 4.75966e-30
Total Hit Count 250
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig99
tttttttcCCCGCCGCCGCCGCCTCCtcccccttcCTCCTCCTCCTCCTCGCCGCTCGTCGCTCCCGCCGCCGCGCCACCGCCGTCAGCCATGGCACCGA
AGAAGGAGAAGGCGCCGGCGGCGTCGTcgaaagCCGGCCAAGTCGGGCGACGGGAAGCAGAAGAAGAAGAAGTGGAGCAAGGGCAAGCAAAAGGAGAAGG
TGAACAACGCGGTGCTCTTCGACCAGGCCACCTACGACAAGCTGCTCACCGAGGTGCCCAAGTACAAGCAGATCACGCCCTCCGTCCTCTCCGAGCGACT
CAGGATCAACGGGTCGCTGGCTCGCAGGGCCATCAAGGACCTGATGGAGAGGGGGCTCATCAGGATGGTGTCGATCCACTCCAGCCAGCAGATCTTCACC
AGGGCCACAAACACCTGATTTACCTACCTCATGTGTTAGCTGCCTGTTTTCTAGTCCAGTAGACTGAGATGTCGCTGTTATATTGACGTTCATTATGTTC
AGCGAGgcactttgtgggtcttgtcttgcgctcgtgccacaagtatgtttgaattgcttttgagtttttggtacaatctaagacgcaatgaaatctacct
tatatatcagac
page-top