Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig1640
Contig Information
Length 588 bp
Tissue Dormant seed with water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whem18l24    rwhem4n20    rwhem18l24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19641 [Oryza sativa Indica Group]
Score 486
Evalue 2.24415e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig1640
CTCATACAGGATCATAACCATCATCGCCGACATCAAAACAAACTCTTGAAACTGATTGTATGCCTTAATAGTTCTGGAACGAGATACGCAAAGCCCATCA
CATAAAATTGGAGCAAAACTTCAGGTGAAAGAACGGGTAATGATGTGGAGTGAGTCAGCATAGGATGCACAATTGCTTGGTGGGTTGGTTGGTTCACTCG
TCCTTCTCCGCCAGCGCAGCCTTGCGGCTGCTCCTCTCAGCGAGGACCGACTTGGTCTTCTCCAGCACGCCGAAGAAGATGGACCCGCCGATGCCGATCC
ACAGAACTCGCGGCTCGATGCCCTTCAAAAAGGCGCCGGGACCTTCCTCCCTCAAGATCGTCTTAGCACAGCTTACAATTCCAGAGTATTGCTTTGTTTG
CCCCTGAACCATCAACCTTGTCTTCAGAACATCGAGGGGGGTTGTTATAGCACCAGTAATCGCACCGGCAAAGGCGCCAATTAGTGCATTCTCTGGATCC
TTCAGCTCCCTCTTTGCCATAAGCTTGTAACCAATTCGAAGTTGCTCGTATATGCAGAATTGAATGGCATCAAACGGAAGATCTCGAA
page-top