Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig1609
Contig Information
Length 740 bp
Tissue Dormant seed with water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whem1b06    rwhem1b06    rwhem1b13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0646500 [Oryza sativa (japonica cultivar-group)] >gi|51535416|dbj|BAD37315.1| putative ATP synthase delta chain [Oryza sativa Japonica Group] >gi|51535638|dbj|BAD37612.1| putative ATP synthase delta chain [Oryza sativa Japonica Group] >gi|113596239|dbj|BAF20113.1| Os06g0646500 [Oryza sativa (japonica cultivar-group)] >gi|125556268|gb|EAZ01874.1| hypothetical protein OsI_23896 [Oryza sativa Indica Group] >gi|125598035|gb|EAZ37815.1| hypothetical protein OsJ_021298 [Oryza sativa (japonica cultivar-group)] >gi|215700976|dbj|BAG92400.1| unnamed protein product [Oryza sativa Japonica Group]
Score 588
Evalue 5.64978e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig1609
ACCTCTCCTCATGTTTTTATCCATGTTTTTTGGCAGAAAGGAAATTAAAGATTGTTCAGCGGGCTTCTTCCTAACCCACAAGACAAAATAAAACAGAGTG
TCGTTCTCTTGTAAAGGTAAGCTTTTATTTCAAGACCACATCGAAGAAGCAGACATGAGGGAACCTTCAGCGGCTCAGCCACTGCACTCTGGTGTTGATT
TAGATCCGAAGGCGGTTAGATGTCAAAGGGTAGTCTCAAGAATGCCTCCATTTGCTTCGCCCTAGTCTTGATCGACATGTCAAACACCTTCTGCCCAAAT
TCAATCACCAGTCCTCCCATGATACTCTGGTCAATCTTTTGTTCAACCAAGATGGTTTTGTCTTTCCCAAGGATATCACGCAAGGTCTCCTTAAGTTCTT
TCTCCTCCTTATCAGGAAGTGGAACAACAGTCCTGACAACAACTTTCACCTCCCCCCTATGTGCCATGGTCAAATCAACAAATCTCTCAGCAATGCGTTC
AACATATTTCAGTCTTCCATTGGATGCCAGTGCAGACAAGAATTTCTTTGTGATGTCAGTAAACCCGGCTTCAGAGAATATTTCAGTTATAGCCTTCACC
CTGGTTTCTTTAGGCACTGATGTGTCCTTCATGAATTGAGAAAACATAGGGCTCTTCTTGGATGCCCCTACAACATCGAGAATCTCGGATTCAACTTTTT
CCACGAATTTGCGTTGGCTGCTGCAAGGAACAACGCACTA
page-top