Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig98
Contig Information
Length 1102 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl46i03    rwhfl46i03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0546900 [Oryza sativa (japonica cultivar-group)] >gi|113624393|dbj|BAF24338.1| Os08g0546900 [Oryza sativa (japonica cultivar-group)]
Score 528
Evalue 4.09885e-100
Total Hit Count 105
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig98
ccggacgcgaggggaagccacggcgccgcaccgacagctcggaggagagcgttgggggcggcggcggcggcggcggcgatggggctgctgtcgaaccggg
tggagcggtcggaggtcaggcccggcgaccacatctacacctggagggccgtctacgcctactcccaccacggtatttatgttggaggaagcaaagtggt
ccattttacacgaaagaaggaagttgaatcttcggattcatccaactccatctctggcctgatctcacgggcttcatcagagtgcccaacattcccagac
tgtggttttcagctggccgatagtggcgtcgtactcacctgcttggattgctttcttgggaatggctccctcTACTGCTTCGAGTACGGAGTGCCACCTG
CAATTTTCCTTGCAAAATTTCGAGGGGGAACCTGCACCATTGCCCAATCAGACCCAtcgggaGGTTGTGGTCCGGAGAGCTATGCACTTGCTTcagaatG
GGTTTGGCAACTacgacATCTtcgagaagaattgtgaggactttgcactctactgcaagactggacttgtacccgttgatgaaccaggcattggggtgag
cgggcaagcatcctccgccattggcgtgccactggcagctcttctgtccactccgttcaagattttcgctgccggtccgcttggaatggccactgtcaca
gccgggatgtactgtgccggtagatacatcaccgacataggagtaagaaaggatgtcgcgaaagtggaagtggagaacttgtcgtcgcaccttggcttcc
gccgcgtagaagatgcagaatcggtgaacaagagctcagacaaagtgaagaagctgctcccgttgaagagaaagcgcgagaggtgagctcggcgatgcaa
tttgggggagtatgagcttgtctgcgcttcgtcgtcggttgttggtgcggaactgtggataatatcgaatctatgcttcagtatattaaggtcgatatat
atatagataataatgtaactatggaacttgctctcgtttggttgagtgcgcacttcgcatgatgagctcaagaattctccgaactggttatggaagaaat
ca
page-top