Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig95
Contig Information
Length 761 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl46p14    rwhfl46p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa] >gi|31433663|gb|AAP55147.1| NADH-ubiquinone oxidoreductase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|125533060|gb|EAY79625.1| hypothetical protein OsI_34770 [Oryza sativa Indica Group] >gi|125575792|gb|EAZ17076.1| hypothetical protein OsJ_031285 [Oryza sativa (japonica cultivar-group)]
Score 444
Evalue 2.95007e-42
Total Hit Count 71
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig95
ctccaatccccacgacgagatccatccaccctagaggccaagaagaGAAGGGAGGAGAGAGAGaggccggcgGCGGCGGCGGAGCAGGCGATCGGAGATG
GTGCGGAAGGCCAAGGTCGAGTTCGACGAGAGGCCGCCGGATGACTTCGACCcgaaagAACCCGTACGGGGACCCGGTGGCGATGCTGGAGTACAGGGAG
CACCTGGTGCGGGAGAAGTGGATCCAGATCGAGACCGCCAAGATCATCCGCGACCGCCTCCGCTGGTGCTACCGGATCGAGGGCGTCAACCACCACCAGA
AGTGCCGCCACCTCGTCGACCAGTACCTCGAGTCCACCCGCGGCGTCGGGTGGGGCAAGGACCACCGCCCGGCGGACCTCCACGAGCCCAAGAAGGTGGT
CGAGGTCGAGGACtagcaCGGTTGCTTCCGCCGCCATTCCTGGAATGGAGAGGTCATCTTTCCATtcgaagTGAAGTAACTTGAACTGCCGcagctCCTC
TCTTACCTCTGAAGTTGCTGATAGGcatttaataaatgatgatgcgaagcaaacattgttgtgtggtgtctgtatttttttttgttaacttgaaggagtt
aagcaaatcgttgcttggacttacctaccttgtttccagtttcatttatacaaatgatgtttagctgcccttgcctttgcatcttgagtttacaactgta
cgaaagacggctcttgctgtgctgtacgagttctttctattttgtccctgtgctgcttttt
page-top