Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig1227
Contig Information
Length 702 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem5j17    rwhem5j17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoethanolamine methyltransferase [Triticum aestivum]
Score 859
Evalue 1.90513e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig1227
CGCTCGTGCTCGGTTGAGTTTGAGGTTGCTGACTGCACCACCAAGGAATATGCAGAGAACACGTTTGATGTCATCTACAGCCGTGACACCATCCTCCACA
TCCAAGACAAATCTGCTCTGTTCAGAAACTTCTTCAAGTGGCTCAAGCCTGGGGGCAAAGTGCTGATCAGTGACTACTGCAGGAGCCCTGGCACACCATC
AGAGGAATTCGCTGCGTACATCAAGCAGAGAGGCTATGACCTCCATGATGTGAAGACCTATGGGAAGATGCTTGAGGATGCCGGTTTCCACGATGTTGTC
GCCGAAGACCGCACCGACCAGTTCCTGAGGGTCCTGGAGAGGGAGCTGGGCGAGACAGAGAAGAACAAGGAGGCCTTCCTGGCGGACTTCACCCAGGAGG
ACTACGACGACATCGTCAACGGCTGGAGCGCGAAGCTGAAGCGGAGCTCCGCCGGCGAGCAGAAGTGGGGGCTGTTCATCGCGACCAAGTGATCTGGCCG
CTGAGCAGCGACGCCATGGACGCGATGATTCGGGAGCAGAGCAGCTTCTGTTAAGAAATAAATAAAGAGGATCGGTGCTCGACAATGTTGTGGCCGTGTG
TTGGGTGTGATTGTTTGTTTGTTGCAGTGGCTGCATTCACTGGCTGGGCACCAGGATCTATAAGATAATGTGTACGTACGTACGTACCTGTATTCCCTGA
AC
page-top