Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig94
Contig Information
Length 536 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl19j06    whfl50j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35151 [Oryza sativa Indica Group]
Score 372
Evalue 1.77824e-41
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig94
aagGCCACCACTATACTCACGCTCTCCTCGTCCCCTGCCGCCGCGGCCCGCCGCTCGCCGGCGAGGGCGACCATCTCCGACCCCCACCTCCGGCAGTACC
CCGTCCGCACTTCCCGCCTCCGCGTTGCCCAGAGCCTGGCCTCACGTCCCCTATCCTCGGGTTGGAGGCGGCGCCGGAGGGGGAGCGGGCTGGTGGTGCG
GGCAGAGACGTTCGGGCAGCTCACCACCGGGCTCGATTCCGCGTGGAACAAGCTGCGTGGCGTCGATGTGCTGACGAAGGAAACCATTGTGGAGCCGATG
CGGGacatcAGAAGAGCACTTCTGGAAGCAGATGTTAGTTTGCCGGTCGTCAGACGGTTCGTGTCGTCTGTGAGCGAgaaggctttaggttcagatgtta
tcagaggaatccgaccagagcagcaattagtcaagattgtgcatgatgaacttgttcaactgatggggtggagaggtatcagacttggtgttcgcaaaaa
ctggcccaacggtcatcctactggcaggtctgcaag
page-top