Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig93
Contig Information
Length 717 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl24f17    rwhfl24f17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003884 [Oryza sativa (japonica cultivar-group)]
Score 747
Evalue 1.92138e-77
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig93
ctctagccgccgCCGCCGCCGTCGCCCGCGAagccccctGCCACCGGAGATCTCCCGACCTCTCCCGTCGCCGCCCCCCCGGAGATCTCCCGGCCTCTCC
CTCCGCCATCATGGGTAAGACACGTGGTATGGGAGCCGGGCGCAAGCTCAAGACCCACCGCAGGAACCAGAGGTGGGCTGACAAGGCGTACAAGAAGAGC
CACTTGGGCAATGAGTGGAAGAAACCCTTTGCTGGATCGTCTCACGCCAAGGGCATTGTCTTGGAGAAGATTGGTATTGAGGCCAAGCAGCCTAACTCTG
CCATCCGTAAGTGTGCTCGTGTCCAGCTGGTGAAGAACGGGAAGAAGATCGCTGCCTTTGTGCCCAATGATGGTTGCCTGAACTTCATCGAGGAAAATGA
CGAGGTACTGATTGCTGGATTCGGTCGTAAGGGTCATGCCGTGGGAGATATTCCCGGTGTCAGGTTCAAGGTTGTCAAGGTATCTGGTGTGTCGCTTCTC
GCTCTCTTCAaggagaaaaaggagaagcccaggtcttagattgcatttttgttaggcaaggatggaatggactgtaaggctctggtcgtttgaggaggaa
agttgcctgctatgtttacaatgtcctatataacctgaagttgtactagcgagatttgttccttctctgctgttgctttctcttaacagttgctattaag
agtattgtttccatgat
page-top