Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig92
Contig Information
Length 831 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl24e09    rwhfl24e09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195634991|gb|ACG36964.1| ubiquitin-conjugating enzyme E2-17 kDa [Zea mays] >gi|195644504|gb|ACG41720.1| ubiquitin-conjugating enzyme E2-17 kDa [Zea mays]
Score 699
Evalue 5.47425e-80
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig92
tccaatccttttgccccccttctctacatagcccccctccatccccgaccctcccttccatcGCCCAGGCCGACCTAAAGCCgtcccaTTCCGTCGTCTC
CATGCTCTAGGACAACGAGCACGCGGAGCCCACGTCTCCACCCCCACCGCCGGCCGCATCTCAGAGAATTTCGAGGATGTCGACTCCTTCAAGGAAGAGG
CTGATGAGGGACTTCAAGCGGCTGATGCAGGACCCTCCTgcggggcATAAGCGGGGCGCCGCAGGACAACAACATAATGCTGTGGAATGCTGTGATTTTT
GGCCCTGACGATAGCCCGTGGGATGGAGGCACGTTTAAGCTGACTCTCCAGTTTAATGAAGAATATCCTAATAAGCCACCAACAGTTCGGTTTATTTCTC
GGATGTTTCACCCTAACATTTATGCTGATGGAAGCATATGCTTAGATATTCTACAGAATCAGTGGAGCCCAATATATGATGTAGCTGCTATACTTACATC
TATCCAGTCGCTGCTGTGTGATCCTAACCCAAATTCGCCTGCTAACTCAGAAGCTGCCCGCATGTTCAGTGAGAACAAGCGAgagtacaaccgcaaagtg
cgggagattgttgagcagagctggacggcagactaataagttgagctcaccatgtgttatcatgcggtttctgtaccaaaatgtttgtaactaaaatgac
tgaactctgtcgttaccacctgaaacagcaacttgctttgttgcatcgtttggctggacggttggagattgctctgtcatggcctgtgtctacactgtct
gtatctggaacgcaaacattttgtaacgtct
page-top