Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig90
Contig Information
Length 960 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl24d09    rwhfl24d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit LOL1-like protein [Hordeum vulgare subsp. vulgare]
Score 311
Evalue 7.88282e-51
Total Hit Count 91
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig90
tgaaatctgcaccagatcgagctcagcaacgcgagccgagccggaggcgttcgtctgcccggggtggcgccatgcggatccgcctcttcctctgaaccgg
gcaagcgcgagccgccttcctcctcgtgctcgacggcggcgacgagcgtcggtggccgcatagcaaagtccagcaacgagcagggtttcatgtaggggag
ggcaacctgttcccagccctcgatttccaccgGAGCGTGCGAAGTCCAGTCGGCAGCAACGGCGACgccgggtGGAGGCAGCCGCGGGCACGGCAATGCC
GGTTCCTCTTGCCCCTTACCCAacccctcCTGTGCCCTTCACACCACCCGCTCCCAATGCAGGGGCTCAAAGCCAACTTGTCTGCTCTGGGTGCCGGAAT
CTGCTCATGTATCCTGCCGGCGCAACGTCGGTCTGCTGCGCAGTTTGCAGTACCGTGACCGCTGTTCCGGCTCCCGGGACTGAAATGGCGCAGCTAGTTT
GCGGAGGATGCCACACTCTTCTCATGTACATACGCGGCGCCACAAGTGTACAGTGTTCTTGCTGCCACACTGTCAACCTGGCAAtggaaagCGAATCAGG
TTGCGCATGtaaactgcgggagttgccgaatgctgctcatgtaccagtatggcgcgaggtccgtcaaatgtgcagtctgcagtttcgtcacgtcagttgg
ggcatcatcgggtgcagagcagaagcccagcaactgaactcctgcaactttatttgggaagcagcaccccggaataagaatgctttgagtgcacatgtat
agagttcttcccagaagcaatctcttcctcccctctccatttcccaccttcgttggacctggcgagcttgcggaataaacaagagtttttggtaatacat
agtgctcaaaattcgtcgaatcatctgtgtaactggatcagacagatatatgaacccacc
page-top