Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig9
Contig Information
Length 580 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl6e08    whfl7m04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ubiquitin carboxyl-terminal hydrolase 26; AltName: Full=Ubiquitin thioesterase 26; AltName: Full=Ubiquitin-specific-processing protease 26; AltName: Full=Deubiquitinating enzyme 26
Score 724
Evalue 5.52353e-75
Total Hit Count 139
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig9
gtCACTGGTGGGAGTTTGATGATGAGTGTGTATCCAGCCTTGGTTTTCACCCTTTTGGTGAAAAACCAGGCAAGTCATCTGATAAAGCGGATCAGAAATC
TGAAGGTACTTCTACCGAAGGCTCTGTGGCAAATGGTAATAACAGTAGCCATCATGATGCTGCACCGACTTCTAATATGGGAGAGATGTTCTCTTCCACT
GATGCTTACATGCTAATGTACAAACGTTCGAGCAAGGATGAAAATGGTATTAAAAGCAATAATATTGTGGAAGCCAGTAATAGTTCACTTCCACGTCATC
TGATGGATGAGATTGATGCATTGAATGCATCATGTGTAAAGGAATGTGGCGAGTACCTAAGTAAAAAAGATAACCTTTTGGCTTCCATACAAGAAAGGCG
CCAAGAAATAAAATCTGTTATTACAGAAGCACCTGCTACTCCAGACGACGATTCATATTTTTGGATTTCACTAGACTAGCTTCGCCAATGGGCGGATAAT
GCTACCCCTCCCTCTTCCATTGACAACAGTCCAATTCAgtgtgaacatggaaaagttccagcatctaaagtcacatccat
page-top