Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig89
Contig Information
Length 539 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl48a18    rwhfl48a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0781300 [Oryza sativa (japonica cultivar-group)] >gi|12957706|gb|AAK09224.1|AC084320_11 hypothetical protein [Oryza sativa (japonica cultivar-group)] >gi|108711389|gb|ABF99184.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113549927|dbj|BAF13370.1| Os03g0781300 [Oryza sativa (japonica cultivar-group)] >gi|125588130|gb|EAZ28794.1| hypothetical protein OsJ_012277 [Oryza sativa (japonica cultivar-group)] >gi|215767884|dbj|BAH00113.1| unnamed protein product [Oryza sativa Japonica Group]
Score 296
Evalue 2.52434e-27
Total Hit Count 21
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig89
aagGGAGCAGGCATGGCGTCGGAGATGCTGCTCAGGAGGATCCATTCCATCTGCCGTCTCGCCCCCGGCGACCGCCAGtcggcAGCTGTTCGGACGCGGG
GAGGGGCTCCGCCGTCTGGTTCCTACGGCGAGCCATCCATCGTTCTGCAGCAGCGTGTGTGAGCAAGCCGGCGCGGGCAGCGCAAGCAAGGATCAAGATA
ACCTCGCTAGGTTTTCAGACCCACAGGTTGCTCACGAGGATCGCCGGTTCGTTCAGTTCTTGGATAGGATGCTGGACGCGACGAGAAATCCCCAGAGTCT
TGCGCAGATACGGCGCGAGAAGCTTCCAAATGATGTGAAAATATTGGATGATGAGATATGAGTCAAGTTCTCTTACAGGAATATAATAAGAGTTAACAAG
CGTGATTTATGACATGTAAAGTGACCTTGAGATTAACCTGCCAAACTTGAGCATGTGAGATTTTTATTATTCAAGTTCTAATTGTGGACCAAAACACCAG
CTGATGAAAATATattgtgcattttgagcaaaaaaaaaa
page-top