Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig240
Contig Information
Length 688 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem4h23    rwhem4h23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 2.04647e-33
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig240
TCCGCTCCCCCCTCCCGCCGCCGCCTCCAGCCTAGGGTTTCCTCCCGCCGTCCGCCACACCCGCCGCCATGGCTCGCCGCAGCGGAGGAGGAAGATCTTC
CCGCCCTGCTCCACGTGCTGCTCCAGTGAGAAACCCACCAGCGCCAGCCCGTCAAGCTCCTCCACCTGCTACTACCCAGAGCAGCGGTGGTGGTATCATG
AGCGGAATTGGGTCCACTATTGCTCAGGGCATGGCTTTTGGTACTGGCAGTGCTATGGCGCACAGGGCTGTTGATGCTGTGATGGGTCCCCGTACCATTC
AGCATGAGACTGTTGTCGGTGAGGCTGCTGCATCTATGACTCCAATGGACAACGCTGCTGATGACAAGTGTGGCAACCCTTCCAAGGCCTTCCAAGATTG
CATCAACCACTACGGCAGCGACATCAGCAAGTGCCAGTTCTACCTCGACATGCTGAACGAGTGCCGCCGTGGAGGAGCAGGAGCTGGTGCAACTCTTTAA
GCTACTATCTTTGCTTGATTGGGGCTTAATTGGTCGGAGCCTGTTTTCAGTCATGATGATGATGATATATATCTCCTAAATAATTCATTGGCAATATTAT
GAACCTATGCCACAGCTTATGTCTATTACCTACCCTAGTTTGTGGTCTCTGTTGTCTTGGGAGTATTTCCCTTGTATTGATGTGGATC
page-top