Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig844
Contig Information
Length 519 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 4 Clones [Download: CSV  ,  FASTA ]
whfl10h13    whfl7g08    whfl35g02    whfl3o10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Heat shock 70 kDa protein cognate 1; AltName: Full=Heat shock 70 kDa protein 70C
Score 317
Evalue 2.61503e-58
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig844
tcGAAATCATTGCCAATGACCAGGGCAACCGCACCACGCCGTCGTACGTGGCCTTCACCGACTCCGAGCGCCTCATCGGCGACGCTGCCAAGAACCAGGT
GGCGATGAACCCCATCAACACCGTCTTCGATGCCAAGCGTCTCATTGGCCGGAGATTTACCGATTCAACTGTCCAGAGTGACATTAAGCTGTGGCCCTTC
AAGGTTGTTGCTGGACCTGGTGACAAGCCTATGATTAATGTCCAGTACAAGGGTGAGGAGAAGCAGTTTGCAGCTGAGGAGATATCCTCTATGGTGGTGA
GGACTTTGATAACAGGATGGTCAACCACTTCGTCCAGGAGTTCAAGAGGAAGAACAAGAAGGACATCAGTGGCAACCCGAGAGCTCTTCGGAGGCTGAGG
ACATCCTGTGAGAGGGCAAAGAGGACTCTCTCCTCCACTGCACAGACCACCATTGAGATTGACTCGCTGTTTGAGGGCATTGACTTCTACTCCACCATCA
CCCGGgccaggtttgagga
page-top