Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig100
Contig Information
Length 466 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7g18    rwhem7g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein SNOG_14198 [Phaeosphaeria nodorum SN15] >gi|160704666|gb|EAT78435.2| hypothetical protein SNOG_14198 [Phaeosphaeria nodorum SN15]
Score 451
Evalue 1.49008e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig100
CCAACGGCCAACACATCCCTGCCGGTGTCATCATCGAAGTTCCCTCGCACGCCGTCTACAGCGACCCTGCGCTGTGGCCCGACAGCGAGAAGTTCGACGG
CCTCCGCCACTACAAACTCCGCCGCAACGGCGGCTCGACGGACCACGCGCGCAACCAGTTCGTCACGACCAACGAGCAGAACCTGATGTTCGGATACGGG
CGGCACGCGTGCCCCGGGCGCTTCTTCGCTACCAACGAGATTAAGATGATTGTGGCGAAGATGATCCTGGATTACGATATCAAGATGCCAGGGGGGCTGA
CGGAGAGGTATAGCCAGATTGAGCAGGGCAAGGGGTCGAATCCGGATCCGACCAAGACGCTACTTTTCAGGAAGGTGAGGGTTTAGGGCGTGGTTGGTGG
GGGTTGATGAGGCGGATGAGGTGGATGAGGCGGGATAGAGCAAGGGATATAGCTGATGGAGAGTTT
page-top