Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig83
Contig Information
Length 630 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl48j12    whfl48j12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L31 [Zea mays] >gi|195606672|gb|ACG25166.1| 60S ribosomal protein L31 [Zea mays] >gi|195617160|gb|ACG30410.1| 60S ribosomal protein L31 [Zea mays] >gi|195639880|gb|ACG39408.1| 60S ribosomal protein L31 [Zea mays]
Score 486
Evalue 2.66719e-47
Total Hit Count 394
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig83
ccgtcTCGCGCCGCCGGAACAGAATCGACCCGGAGGGAGGAAGCAGCAGCAGCAGGTCAGCGAGGGAGGAGTAGAGGGGATGGCGGACAAGAAGGGCGGA
GCGCCGAGGAAGGAGGAGGTCGTCACGAGGGAGTACACCGTCAACCTCCACAAGCGCCTCCATGGCTGTACCTTCAAGAAGAAGGCACCTAATGCCATCA
AAGAGCTCAGGAAGTTTGCACAGAAGGCTATGGGCACGACAGACGTCAGGATCGACGTGAAGCTCAACAAGCTCATCTGGAGCAGTGGGATCAGAAGCGT
GCCCCGTAGGGTTCGCGTGAGGATTGCCCGCAGGAGGAACGACGAGGAGGACGCCAAGGAGGAGCTCTACTCACTCGTCACTGTTGCCGAGGTGCCTGCT
GAGGGTTTGAAGGGGCTGGGAACCAAGGTTGTCGATGACACTGAGTAGAATCTTTCTTTATCTACATCGTTAGAATGAGCTGTTATTTTGCATTGCACCA
GCATGTTTTTTGTATCCCATGGAAGTTTTGGAGTATGGAATATCGCAAGCTATCTATTTTCCTTCATctaaatcttgatggttggttttgcccttcatac
tgtgctcgttattggcgtcaatacaggata
page-top