Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig98
Contig Information
Length 373 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17j22    rwhem17j22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27847 [Oryza sativa Indica Group]
Score 94
Evalue 0.0381734
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig98
TTTCAGCAAGACGATTCTTGCGAAGTTTGGATGGGCAATGGATGTCGAGCCGGATTTCAGATTCTAAGAGTATTGGCTTCCGGGTGAGCCAATGGCCCCT
TGGTAAATTCGATTCAGCTTCCAGGCCTTCTCCCGGACCCCTAACTGCAACTAGTAGTAAAGGAAGAGCTCGGTGTTTGTTTTTTAAGTCCCCCTGCTCC
TGGAAGAAGGAAGCACCCAGCATTCTCTTTGTAGGCTCTTTTTTTTTCTTTCTACCCATCTTCTCTTCTGTACTTGCTATGGCCCAATTGCCTAAAGTCG
TGTTTTGCATTTCATTTGGGCTGACGGATTTTAGCTTGTTGAGAACTGATGGACATTCATTTTAAAAAAAAAA
page-top