Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig97
Contig Information
Length 699 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16g16    rwhem16g16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit olfactory receptor Olr304 [Rattus norvegicus]
Score 77
Evalue 8.99022
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig97
CTCCTATTTATTTGATCCGCCCGCCGCCAAAAACGTCGCCACCACTTCAATCCTAGCCGCCTGATCCAGGTCCGATGGGCTTGCCACCGGCTGCAGCGGC
AACAACGTCTCCATGCCTACATCCTCCGCTAGCGCAGCCACACGCACGAGGCGTGCAGCCATGGGCGTCGGGCGTGTGCGGCTTCACCGGCGCTGCTCGG
TCGCCATGGCTCTGCTGCTAACGATGTGGACTAGCCACATCCTACTGCTACTGCTGATCAAGGTGAATAGATGCTTATGGACTGATTCAAACCGAGGTGG
AGATAGATAAGAAATCAAGCAAGAAGGGCTAACACAAGAAGGTACTTGATTAGTACCTGGTGGCGCATGCAACCCAAAGATCTTCACCGCAGTGAAGGAC
AGCAGTGTGGTAGAAGGTGAAAAGGCAAGTGGTGGGGGTACTCCAGCGTATGTGTGTGTGAGGTAGAATGGTCCAGTGAAAGGGATGGCTCCTATTTATA
GTGGGGTGAATAGCTATGTCGGTTTGAAGACTCATTACATCTGGCATGCATGCGTGGTTAGTCTTGCATGCATGCCTCCACTTGTGTCTCTTATGGGTTG
TACTACGGACAGGTGTAATTTGCTTGGCTGGCCCTTAGTTGGCATTTACTTTATGTGAAAGAAATGAGACAGGGGTCTATAAAATATATGAGGTTGAGA
page-top