Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig96
Contig Information
Length 703 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16d20    rwhem16d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Plasmodium falciparum 3D7] >gi|3845256|gb|AAC71930.1| hypothetical protein PFB0705w [Plasmodium falciparum 3D7]
Score 98
Evalue 0.0333364
Total Hit Count 199
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig96
CTCGCTCCTCCTGTGGGCGGCGCCGCCGCTGCGCACAAAACACATCCTCGCCAGCGTAGCTTCTCCGGCGTCCGGCCAACGCGCTCACTAGCCTCCCGCC
TTCCTCCACATCTCCTCGCCTCCACCCCATCCAGTTCGTGCCATTCGCTGCTCCAAGACAAGGGCATGGCGCTCGGCGGCTGCGGCAACGAAGCTGATGG
TGCACGAGCCAACCATGAAGGCAGTAGCACGGGGCAGCGACAGCAGCATGGAGGGCGTCCTCTTGTTTGGGAAGGTAATGGAACTGCAAATAGGAGTGGC
AGCGGCGACCAGGATGCAAATGGAAGTGGTTCCCAAAGACCTTGGAAAGGACTTAAAGACAATAACTTTGCAATGCTAAATGGCACGTGAGCAAAGGATA
TCAAGAAGCTTTTGGATGTTGGGAAGCTTGGAGCTGATGCTTCAAATAAGCTGATGGTTGTCTTTTGGAGATGTTTCTATGTTTAATGCTTTAAAGTCTT
TTGGCTGTACTGGACTATTTAAACTTTGAACTATGCTGTGATGGTTGAACTGATGTTGGACGGTTAAGGGTTTATGTCAGAGGCAACTTTATAACTAATG
TGTGTCTGTTATGTTGGACTGTTAAGGGTTATGTTGGAGGCAATTTTATAACTAATGTGTGTCTGCTATGTTGGATTGTTAACTGTTATGTTGGAGGCAA
CAT
page-top