Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig95
Contig Information
Length 589 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem17j14    rwhem17j14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein FG00046.1 [Gibberella zeae PH-1]
Score 78
Evalue 4.65361
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig95
CCACTGGCTAGCAGTGCATGAGTGAAGGTATTGCTTGATGATAGAGGGGACCGAGCCCCTGTATAAATACCTGAGCTCGTTGCATCAACCTTGTGTGAGT
TCTGGCCCCAACACATTTACAAAAATAAACTATAATTCACTGGCAACTGTTGCTGCCTGTGGGGAGCTTATGAAAGGATTTTGACATGGATCACTCTTTC
TTCCTTTCACGAGAATGATTTTAACCATGCTGACTTTTCTGGTACTGAAGACTGAAGAGTTAACTTTGATAGCTCTCGGTACAATTGACACGGTTAAGTA
TCAAGCTCGCCCTCCGTTCACTTTCAGCTGCATGGCGAGCCAGACTCCTTCCTTCAGTGTTGGATGATACACGTCTAGCAACTCAGCCCTGTTCCAAGGC
TCGTTCTGGCCCCAGCATTGGAAGCTTACTGAGAAGTCATGGGTGCCTAGCCCATCAAATTCTTCACCTTGCTGGTGTGCCAAAACTGCTACTAGAGTGC
TGCACTTGCTCGCATGTATGCTACCGGAAATGATGCACTCGTTCTTGTTCTCAAGGCAGACTTGGTTTTGTCCTGGATAAAAAAAAAAA
page-top