Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig94
Contig Information
Length 900 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem16d21    rwhem16d21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0133900 [Oryza sativa (japonica cultivar-group)] >gi|108706041|gb|ABF93836.1| serine O-acetyltransferase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547350|dbj|BAF10793.1| Os03g0133900 [Oryza sativa (japonica cultivar-group)]
Score 840
Evalue 4.80391e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig94
CCTTCAAGGAAGAGATCCTTCCTGCGCACAATATAGCTGGGCCCTATTATACCTAAAGGGTTACCATTCCTTGCAGTCCTATAGGATAGCTCATGTATTA
TGGAATCAAGGGCGTAAGGTTCTGGCGTTGGCGCTGCAAAGCCGTATCAGTGAGGTTTTTGCAGTGGATATACACCCAGCTGCCAAAATTGGAGAAGGAA
TATTGTTGGATCATGGAACAGGTCTAGTCATTGGTGAAACTGCTGTTGTTGGCAACTGGGTTTCATTAATGCAGGGTGTTACGCTTGGAGGTACTGGAAA
GGAACACGGAGATAGGCACCCCAAGATCGGTCAGGGAGCTCTTCTTGGAGCTGGTGCTACCATCCTTGGCAACATAACTGTAGGCGAAGGTGCCATGATT
GCCGCTGGTTCCCTTGTTTTAAAGCATGTACCGCCTCACAGTATGGCGGTAGGAAATCCTGCGAAGGTAGTTGGCTATACAGAGAAAGAAGATCCTTCGT
TGACTATGAAGCATGATGCAAGGAGAGATTATTTTGAGCATGTTGCCGGTAGTTTTCCTGACAGTAGATCCAACGGAAGTGTCGTGAAATAAAAAACTTG
CAAGGAGGAATGGAATTTTGGACATTTCTACATCCTGGTGGACGTACGGCGCTGGATATTTGGCGACGCCCGAGTGGTGCTTCCCCCTGCCCAGCAACCC
TCTTGTGAGATCATGCAGGCGAGCCCGCCAAGGGTCTCCGGAAGCTCCCCAGATGTATTTATCATGTGCCCTTAAACTGATGCAATAATGTGAAGATGTT
TTCTGTAAAAACTGGAAGGAGTGGTACAGATATATAATCTGTAGAGATCTCCAGCGGCAAGCTGTAGATACCTCAGATCAGAGCGTGTGACCTCAACTAT
page-top