Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig93
Contig Information
Length 599 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7i02    rwhem7i02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13106 [Oryza sativa Indica Group]
Score 294
Evalue 4.36423e-25
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig93
GATTTGGCTACATCTCAAGGAAAGGTTTCGAGACATTTCTGGACAGGCTAAAAATATGCATGCTAGATGTTGGGCTAACCATCCAGGGAAACAAACCTGA
AGAACTGCCTGAGCAGGTCTTGTGCTGTGTTAGGTTGAACGGGATAGATTATGCAAAGTATCAGCCCCTGATGACAAACGGTGCCTGAACTTGGTGACTT
GCAAGGACCAGCTAACCATTGTTTGTTTGGGATCTGGGAGGTGGCCTGATCATGCCAAGGCGCGGCGAGGCCCCTCGAGGTCTCCGGCCAGGAAACCGGA
GGCGGACTCGTTGGTCACCGCCGTAAGAAGCGCGAGCGGCTGCATGTAAATCTGTATATCATTACATGAGCTCCGATTGCCTCTGCTGTTGTTGCTGCCC
GTGATTCTGGAGTTAGTAAATATGGCTAATTTGCCCGTGGAATGGTAGGTTTAGATGCGCTGTCTCGAAACAAAAAATAGGTAGGGTCGGGCGCACCTGG
AACATGAGGAGGATCTGTGGTGAACGCGAGCTGCTTGCAATGGTGTGGAATGTGAACACCGGAGGCGTTGTATAAGTGTAACCCATACCTCATGATCTC
page-top