Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig92
Contig Information
Length 543 bp
Tissue Dormant seed with water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whem7i04    rwhem7i04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvB12D [Hordeum vulgare subsp. vulgare] >gi|3445292|emb|CAA70936.1| B12Dg1 [Hordeum vulgare subsp. vulgare]
Score 453
Evalue 1.22444e-43
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig92
CGCCTCTCCACTTTCGTCTCTCTCACTCACTCTCCCCCTCCGCCGCCGGCGCAGCGTCCTCCCCGCGACTCCGATGGCCAGCAAGTGGGTCAGGCCCGAG
GTGTACCCGCTGTTCGCGGCGACGGGCGTGGCCATCGGCATCTGCGCCTTCAGCCTCCTCCGCAACATCACCGGCAACCCAGAAGTCAGGGTCAACAAGA
TGGGGAGGGCAGCAGGAGTGCTTGAGAACCATGAGGAGGGCAGGCGCTACGCCGAGCACGGTCTCAGAGCCTATGTGCAGGACAAGACCCCCGAGATCAT
GCCAGGAATCAACAAGTTCTTCACCAGCCCGAAATGAAGCACTTTAGTCTCTCTGTGACTCGCTATTAGCAACTGTTGTGGTCAAGTGCAAACCTATTTC
AAGCATTCAGTAATGTTGTCGCGTCCATAATTCAGAGGATATCATAAAGTACCTCTTATTGAAAGAACCATGTGATGTTTGATGGCTTGCTATATATGTG
ATGGTTGATGGCTTCAAAATATCTGTTTCATTGAAAAAAAAAA
page-top